Tu Auto no enciende? AQUI Tips para solucionarlo!! [i.C]

Hola muchach@s

Tienes un auto, camioneta o moto que no quiere arrancar?... no tienes dinero para un mecanico??

Entonces continua leyendo. esto sera rapido y sencillo, nada de complicadas explicaciones ni nombres tecnicos.
Lo que mostrare en este post le cabe al dedo al propietario de un auto que no va mas alla de subirse y conducirlo, como diriamos en la informatica un "user Basico" que lo utiliza pero no abre el capot por miedo o la sencilla razon de que no le interesa ver todo ese desastre...

Ahora, Imagina un paseo de verano, por la noche, en medio de un bosque, te paras a orinar, cuando vuelves a tu chevrolet corsa 1.6 naftero giras la llave yyyyy... plop! ... its dead! no arranca!!!... sin grua, sin señal de telefono, TODO MAL!!!!. que es lo primero que se te vendria a la mente???
Tu Auto no enciende? AQUI Tips para solucionarlo!! [i.C]

Y aqui es donde comienza lo bueno.




da lo mismo si es un FIAT 600 o un MERCEDES SLK 2012, todos los motores trabajan bajo el mismo principio, se comprime una mezcla aire/gasolina y una chispa en el momento indicado la hace explotar, la explosion mueve un piston y viola!!!

Ok, pero como hacerlo yo mismo sin saber mucho de casi nada??


Como dijimos la mezcla de aire/combustible debe ser encendida por un medio y este es la chispa, la chispa la provee una bobina que al ser recorrida una corriente de 12 volts (bateria) genera una alta tension (4000 a 9000 volts) [no te asustes, es de muy baja potencia, si te da un golpe lo sentiras fuerte pero nada mas, es como cuando desarmas esos encendedores piezoelectronicos que dan una chispita y troleas a tus amigotes con golpes electricos ]. La chispa recorre el cable especial super aislado y llega a el elemento que hace que la chispa se manifieste:
La Bujia... bomba

Todos los vehiculos Nafteros o bencineros usan bujia LOS DIESEL NO USAN BUJIAS (mas tarde les cuento por que)... Bueno ahora a comprobar chispa, primero busca los cables de bujia, te pongo una foto como ejemplo: ford

Ahora, retira uno de ellos con el motor detenido, con un poco de fuerza retira 1 de los 4, da lo mismo cual y apoyalo en cualquier superficie metalica del motor, si quieres sujetalo con una de tus manos, pero ten cuidado por que la chispa te puede saltar a ti y sera desagradable. luego dile a algun amigo o el que te acompañe que le de arranque al motor, mira si desde el cable salta una chispa azul hacia el metal... si es asi tu problema esta en otro d elos 2 items para el exito, compresion o gasolina.

Bien, si tienes chispa pasa al otro item... si no tienes ve rapidamente a la caja de fusibles de tu auto y busca los fusibles marcados como:

Estos fusibles alimentan la inyeccion electronica y por ende, la chispa asi que ya sabes por donde empezar.


En los vehiculos que no usan carburador (1994 en adelante) es facil determinar si hay combustible entrando en la camara, solo debes seguir estos pasos para saberlo y determinar tu falla.

Primero, al dar contacto debes escuchar que la bomba funcione. si tienes un auto quita el asiento trasero por un momento y pon oreja en esa cosa redonda de donde salen mangueras y cables, foto: problema
ahi es donde esta montada la bomba, al dar contacto de escucha un ruido muy bajo TTSSSSSSSSSSSS y luego se corta, eso nos dice que si esta funcionando la bomba de combustible.

Si no hay sonido ve a la caja de fusibles y busca:

POMPE (franceses extraños)
GAS (algunos chrysler)


Cuando tuve una Ford ranger 1994 me paso que fui a buscar a mi hijo a su escuela y me pare para que subiera con su madre, ella se subio y perdio el equilibrio, se afirmo en la manilla y dio una fuerte patada al piso del copiloto, luego se sento normalmente y cerro la puerta. de pronto la troca se detuvo y no partio mas ... realice las pruebas basicas y me di cuenta de que no tenia bomba de gasolina, los fusibles estaban bien y no si con el problema, comense a seguir la linea de la bomba de combustible (luego de 1 semana sin saber que diablos era) y llegue a un aparato que tiene un boton rojo muy tentador, lo presione y la camio volvio a la vida... este elemento corta la bomba de combustible en caso de un choque o golpe fuerte, se encuentra en el piso bajo la alfombra del acompañante, por eso cuando mi esposa golpeo fuerte el piso se activo y todo se fue al carajo.


Si tu auto no cuenta con ese elemento fijate si tu alarma esta activa y no este actuando el antirobo, si tienes un PEUGEOT o RENAULT ve al manual para desactivar el antirrobo... si no tienes el manual mandame un MP


Es muy dificil que falle la compresion en los 4 cilindros de un motor simultaneamente, la mayoria de las veces fallan 2 cilindros contiguos, es decir el 1 y el 2, 2 y 3 o 3 y 4, en estos casos la falla esta en la junta de culata y necesitas ir a un taller especializado, un comun de los mortales no puede hacer esto con un martillo, asi que no pases rabia tratando de solucionarlo, pero igual te dire como comprobarlo.

paso 1
quita las 4 bujias sin perder el orden de los cables
paso 2
en el orificio donde van las bujias aplica con una cuchara sopera aplica aceite en el interior, no te pases, solo una cucharada
paso 3
vuelve a colocar las bujias y los cables y da arranque, si arranca y humea y luego se para es clasico problema de desgaste de anillos y debes acudir a un taller (y tener mucha pasta).

ESTE ULTIMO PASO SOLO HAZLO EN CASO EXTREMO cuando ya se ultra comprobaron todos los otros items.

Si tienes buena memoria ya puedes lograr arrancar cualquier basurero.


Si esto no te resulta util hoy no significa que mañana no lo necesites.

Mis mas sinceros respetos
McGiver Tsistemas.

Fuentes de Información - Tu Auto no enciende? AQUI Tips para solucionarlo!! [i.C]

El contenido del post es de mi autoría, y/o, es un recopilación de distintas fuentes.

Dar puntos
58 Puntos
Votos: 10 - T!score: 6/10
  • 4 Seguidores
  • 19.011 Visitas
  • 10 Favoritos

52 comentarios - Tu Auto no enciende? AQUI Tips para solucionarlo!! [i.C]

@JuanCholseau Hace más de 1 año +1
Glacias muy buenos datos tengo un susuki fun que no arranca voy a probar.
@Tsistemas Hace más de 1 año
Luego me cuentas!!!!
@JuanCholseau Hace más de 1 año
Fue por una bujia en corto, en el servicio técnico de la marca, no se las cambiaron a los 30.000 km.,si me las cobraron, y siguió por otro buen tiempo con las originales hasta que murió una.
Pase un mal rato gracias a unos deshonestos, pero ya está. Muchas gracias.
@Tsistemas Hace más de 1 año
Me alegro que tu auto funcione bien, los concesionarios a veces contratan personal mediocre y solo venden la estructura y las costosas herramientas mientras que la mano de obra no es la mejor... te propongo un trato, dame la marca el año y modelo del auto + el kilometraje y te envio la lista de items que deben recambiarse en tu auto para que no te vuelva a pasar nunca mas!!!

Como dato: comprar un lapiz sharpie de tinta y marcar filtros bujias y cables puede ahorrarte dinero y estafas.
@crison13 Hace más de 1 año
excelente amigo, tengo un problema tengo un renault 5 no me anda creo que eh cambiado de posicion los cables de bujias este cuenta con platino que puedo hacer en ese caso , pensando que estaba bien todo lo empuje para que andara no andubo mas sonaba un sonido feo como lata, me la he cagado :S? ayuda se ve que sabes
@Tsistemas Hace más de 1 año
No creo que la tengas mala aun, a veces los autos que no arrancan suenan feo por la baja presion de aceite al no encender... vamos al grano.

Primero hay que poner bien los cables de bujias, algo que parece dificil pero que es faclicimo. Necesitas sacar la bujia del cilindro numero 1. el cilindro 1 es el mas cercano a lasa correas y el cuarto esta mas cerca de la caja de cambios.

Bueno sacas la bujia, luego mete una bombilla o pajita o algo plastico que sea un poco flexible QUE NO SE QUEBRE DEN
@crison13 Hace más de 1 año
@Tsistemas no alcanzo a escribir todo el texto parece, en el distribuidor del platino salen marcadas cuales son los cables 1 2 3 4, estan en orden 1 3 4 2, pero de ahi a donde estan las bujias no se ubicarlas, no se si el primero es el que esta cerca parabrisa o el mas lejos ! entonces?
@Tsistemas Hace más de 1 año
@crison13 el primer cilindro es el que esta mas cerca de las correas del alternador, el mas cercano al parabrisas o la caja de cambios es el 4, asi los puedes ordenar. mira este video para entender lo del orden de encendido

mantenme informado
link: http://www.youtube.com/watch?v=M1h9eU9YH5o
@xtemasterx Hace más de 11 meses
+10! me compre mi primer auto y casi no lo use.. me quede sin nafta y no arranco mas.. me parece q es la bomba de nafta electrica. chispa tiene y lo otro ni idea como fijarme.. pero creo q es lo de la nafta.. voy a probar.. si podes mandarme lo de la alarma, tengo un chevrolet corsa 2004 3p base, un saludo
@Tsistemas Hace más de 11 meses
El 3p (en chile swing) es facil de detectar amigo, solo levanta el asiento trasero hacia adelante, veras esto gasolina no toques nada aun, solo pon tu oreja cerca de eso y dile a alguien que de contacto y un toque pequeño de arranque, si oyes un tsssssssssssssssss la bomba esta funcionando bien, si no oyes nada hay que cambiarla (te recomiendo una bomba bosch para que te resulte facil cambiarla tu mismo, no son car
@orco25 Hace más de 9 meses
Hola Tsistemas !!! MUCHAS GRACIAS POR LA DATA!!!
Ayer, fui a darle arranque al chevrolet classic 2011, 48.000km + gnc5ta, y nada, muerto, hacia 2 dias que no lo usaba.
Lo empujamos, y nada, lo puentee con una meriva y nada,las luces del auto prendieron, pero cuando le doy a la llave..nada....lo que no recuerdo, es si al querer hacer contacto, la luz del interior bajaba.
Ahora estoy esperando aun amigo que me va a dar su mano y experiencia....
Puedes enviarme o publicar, como le ofreciste a otro usuario, una lista de items a recambiar o revisar???
@Tsistemas Hace más de 9 meses
orco25 si es el cosa clasic cilindrada 1.6 parte por revisar la correa de distribucion que puede estar cortada si tienes mas de 80.000 km... otra cosa que falla mucho es el sensor de posicion de cigueñal, este esta ubicado en el damper dentado. para confirmar que este bien debes sacar un cable de bujia y poner una bujia de "prueba" en el cable y jujetarla contra algun metal del motor, darle arranque y fijarte si es que la bujia emite chispa. si emite chispa el sensor esta bueno y todo el siste
@crison13 Hace más de 8 meses +1
Mi amigo he hecho como dices, vi el video muchas gracias de verdad sabes demasiado y ayudas muchas muchas gracias, ahora no se si podras ayudarme con otro problema que tengo con el mismo renault 5, responderme por un mensaje privado gracias amigo otra vez, disculpa la demora no tuve tiempo en poder entrar a responder
@Tsistemas Hace más de 8 meses
que bien que te sirva la info... cuentame mas sobre ese renault... aqui en chile hay muy pocos y siempre e querido uno.
@crison13 Hace más de 8 meses
bueno te cuento sobre el renault 5, el problema que tiene es que no tiene fuerza en el motor, es decir piso el acelerador a fondo y sale despacio y empieza agarrar fuerza, en subida pierde fuerza, le hicimos cambio de disco de embrague pero no era eso, sera problema de las bujias o algo por el estilo desde ya gracias
@crison13 Hace más de 7 meses
@Tsistemas disculpa la graan demora pero taringa no me sincroniza las solicitudes, lo hare apenas lo llegue este findesemana, la tapa del distribuidor de bujias? me perdi :S
@Tsistemas Hace más de 7 meses
@crison13 Hace más de 7 meses
@Tsistemas y yo tengo que girar la tapa roja??
@corralito_off Hace más de 8 meses
hola queria hacer una consulta tengo un daewoo lanos mod 99 1.6 sx , siempre andubo a gas y ahora q le compre la bomba de nafta se la coloque le limpie el tanque le cambie las mangueras la bomba funciona y le di arranque , al principio arranco muy bien regulaba perfecto , pero cuando puse primera y sali empezo a galopar , no se por que , ahora no me funciona en nafta, le saque el sensor de oxigeno se lo limpie y nada, le cambie las bujias, cables de bujias y nada, la verdad no se q sera y no se cual es el sensor de temperatura para revisarlo... Saludos...
@Tsistemas Hace más de 8 meses
el problema esta en los inyectores, sacalos y llevalos a limpiar con ultrasonido... no intentes aplicar limpiainyectores milagrosos al combustible por que te quedara peor.

Por que se produce esto?: Al no usar la gasolina en los inyectores se forma un deposito calcareo duro probocado por el alojamiento o aposamiento de gasolina. una limpieza con aire a presion o ultrasonido dejara tu auto rujiendo como un leon.
@emdejesus Hace más de 8 meses
Muy buen post Sencillo,eficaz,practico y sobretodo completo
@Tsistemas Hace más de 8 meses
Muchas gracias.
@nicolasjv Hace más de 6 meses
Hola tsistemas : tengo un corsa 2008 ,1.6 base detube la marcha del vehiculo y a los 15 min lo quise arrancar pero todo funciona solo que no arranca , tiene bateria , combustible . que podria estar pasandole ? hasta lo empujaron y nada , desde ya muchas gracias
@Tsistemas Hace más de 6 meses
es el sensor de posicon de cigueñal, va junto al damper corsa

vale 15 dolares y es facil de cambiar.
@nicolasjv Hace más de 6 meses
Soy yo de vuelta ahora arranca pero cuando calienta empieza a fallar y se para el motor y se queda sin chispa
@Tsistemas Hace más de 6 meses
si empieza a temblar fuerte es por que esta fallando el cilindro 1 y 4 que es una falla tipica del corsa, debes porbar con otra para validar el diagnostico
@Tsistemas Hace más de 6 meses
@nicolasjv Hace más de 6 meses
Así es tiembla a lo ultimo antes de pararce .y por que no tengo chispa luego de ésta. Falla ?
@nicolasjv Hace más de 6 meses
Esto que hago es mas que nada para que cuando le hagan el diagnostico no me estafen ja ja
@Tsistemas Hace más de 6 meses
mira, cuando la bobina se calienta por el calor del motor comienza a fallar en estos modelos, es por que adentro perdio aislacion y entra en corte, enconces la ECU del auto detecta corte a masa en el cableado y se proteje. trata de conseguir una prestada y prueba con ella, solo lleva 3 pernos estrella del 6. esta falla siempre llega a mi taller. ahora si subes un video del sintoma podria ser mas exacto.
@nicolasjv Hace más de 6 meses
Ok en cuanto puedo te subo un video
@Tsistemas Hace más de 6 meses
@ronaldmauricio75 Hace más de 5 meses
Hola, quiero hacer una pregunta, tengo un mazda protege, 2001, y hoy le cambie el fusible de el bloqueo de las puertas y ya no prende, pero todo lo eléctrico le funciona, quisiera saber q se debe esto.

@Tsistemas Hace más de 5 meses
se llama INMOVILIZADOR y pasa cuando la ECU pierde su memoria o el auto detecta que lo estan robando, si le quitaste el fusible con la puerta abierta ese es tu problema... desconecta la bateria 20 minutos con el auto CERRADO, luego conecta la bateria CON LAS PUERTAS CERRADAS y dale a cerrar y abrir desde el control remoto, luego sube y dale arranque normalmente... comenta como te fue!!!
@brosler Hace más de 5 meses
Hola tengo un nissan v16 tiene buena compresion funcionan todos sus componentes bomba de bencina inyectores tiene chispa está a punto y sigue sin encender agradecería la ayuda
@Tsistemas Hace más de 5 meses
amigo, si tiene todos los componenetes para encende y no enciende lea a continuacion:

Si es tapa roja: echele al filtro de aire (si al filtro) medio vasito (de los chicos) de gasolina y que quede bien humedo... si arranca exelente es que la bomba esta mala. Explico: cuando la bomba de gasolina del v16 B13 o TSURU en latinoamerica falla evia una presion media al circuito, parece que tirara bien, pero el v16 es celoso con la presion... entonces cuando paras el vehiculo y quitas la llave queda un
@luala Hace más de 5 meses +1
hola buenas noches! ante todo te felicitos por el aporte! tengo un corsa 1.6 2004 nafta, hoy venia andando y me empezo a fallar y perdio fuerza, el auto arranca y regula, le afloje los cables de las bujias y me da que en las 2 del medio no llega chispa, las otras dos ni bien los aflojo hacen una buena chispa. seran los cables las bujias o la bobina, no quiero ir al teller y que me digan cualquier cosa! gracias.
@Tsistemas Hace más de 5 meses +1
compra la bobina, es muy comun que fallen en los corsas 1.6 del mercosur... Repito, cambia bobina y cuando termines me dejas puntos xD
@luala Hace más de 5 meses +1
@Tsistemas gracias....cambie la bobina y fue un exito
@Tsistemas Hace más de 5 meses +1
@sakaza Hace más de 4 meses +1
Hola. Tengo un corsa classic 2004 con equipo a gas. El auto arranca y para bien. Cuando anda a gas no ay problema. Pero cuando anda a nafta regula por unos minutos y luego de repente se apaga... (a gas no lo hace regula y anda perfecto) Espero tu respuesta aver si puedo solucionarlo yo. Desde ya gracias... a.a. tiene algo qe ver el filtro de aire? o la bomba de nafta? como ago para probar si la precion de la bomba de nafta es la que necesita y la correcta... (la bomba es nueva)
@Tsistemas Hace más de 4 meses +1
Si tu auto corsa anda bien a gas quiere decir que tu encendido (bobina, bujias cables, ecu) anda bien, el tema lo tienes con la gasofa, si lo usas mucho a gas y no lo usas con gasolina ocurre algo muy comun y muy simple, la gasolina pierde su propiedad y se vuelve muy pobre en gas (como la coca-cola abierta despues de 1 dia)... otra cosa muy comun es que el estanque se condense y comiense a acumularse agua, lo mejor seria sacar el filtro de gasolina y verificar si sale agua u oxido o suciedad
@sakaza Hace más de 4 meses
@Tsistemas muchas gracias... cambie el filtro de nafta y quedo funcionando... maldito mecanico me abia dicho q lo abia cambiado. cuando lo saque pesaba 3 kilos de la mugre q tenia adentro. denuevo gracias y suerte...
@Tsistemas Hace más de 4 meses
@sakaza que bueno sakaza, mantener los filtros del vehiculo es lo mas basico y facil... cuando quieras informacion o necesites ayuda aqui seguira este post.
@SARAROGEL Hace más de 4 meses
Hola, quería consultarte, hoy encendí mi auto (suzuki fun) y hacia un ruido extraño como que tenia algo en el motor, di la vuelta manzana y lo estacione, luego lo trate de encender nuevamente y no arrancaba :$ , las luces funcionan, el tablero se encendía pero no funcionaba al darle arranque, que puede ser ?
@SARAROGEL Hace más de 4 meses +1
@Tsistemas Era el motor de arranque, quedo trabada la biela . (se rompio todo). Lo que si estuve bastantes dias en conseguir las piezas de repuesto. muchas gracias por la respuesta!
@Tsistemas Hace más de 4 meses
@SARAROGEL repararas el arranque??? te conviene cambiarlo completo o te seguida dando problemas, es compatible con los vitara, baleno, jinmy y samurais.
@SARAROGEL Hace más de 3 meses
@Tsistemas Gracias por el consejo, ya lo repare , lo cambie por completo, pero costo mucho conseguirlo ya que el tamaño de esos difiere con el que tengo yo, pusieron uno compatible con el chevrolet corsa clasic 1.0,1.4 y 1.6 de marca valeo (el mismo que tenia).
@buhito64 Hace más de 3 meses +1
Amigos taringueros,no lei todos los comentarios,a lo mejor lo dicen,pero ocurre que hoy domingo quise poner en marcha el auto,a Gnc,y no arrancó,si bien anoche lo habia usado,conectè el cargador de bateria,y nada,probè chispa de la bobina y venia bien,probè cable de bujia 1 y llegaba bien chispa,gas llegaba bien al poner contacto,tiene cables tapa distribuidor y rotor nuevos,estaba por darme por vencido,en realidad me dì por vencido por una hora,y se me ocurriò sacarle el filtro de aire que tambien es nuevo,intentè sin en filtro y arrancò,le coloquè el mismo filtro y anda sin problemas,queria compartirlo con Uds,por si les sirve de soluciòn.Saludos
@lucaslopezcasla Hace más de 3 meses
Hola compa te hago una consulta tengo un ford fiesta 2003 y lo que me paso es que saque la bateria y la deje un dia sin bateria y al dia siguiente cuando se la pongo chann no arrancaba mudo ni las luces ni nada lo cargue con un cargador para baterias y nada solamente se calienta la bateria y el agua destilada ase ruido como que hierve que podra ser?espero tu respuesta y exito la verdad que sabes muchoo!!!
@Tsistemas Hace más de 3 meses
OOHH!!! TEN MUCHO CUIDADO!!!!! FIJATE SI LA BATERIA ESTA BIEN CONECTADA!!!... prueba con otra bateria diferente ya que puede que cuando la conectaste al cargador conectaste mal los polos y la bateria se INVIRTIÓ de polaridad. descarta esa bateria y prueba con otra ya que podrias freir el computador del auto y reventar el alternador.

Conectar al revez una bateria puede llevar a consecuencias muy costosas, reemplazar el alternador, La ECU, la ecu del airbag, cableado completo uuffffff... etc.

@jemolux23 Hace más de 3 meses
Hola que tal,

Tengo un Derby MI 2006, este no arranca, ya realice todas las pruebas que estan en esta publicación y no mas nada, si encienden las luces del tablero, si da marcha, pero no arranca espero me puedas apoyar.

Muy bueno tu aporte, gracias.

@jemolux23 Hace más de 3 meses
@Tsistemas muchas gracias, ya hice la prueba y nada, ya escanearon el carro y salio la falla en el sensor de cigueñal, este ya lo cambie y sigue igual, estoy algo desesperado y creo que tirare mi carro a la basura :'(
@Tsistemas Hace más de 3 meses
@jemolux23 jaja no lo tires a la basura y si lo tiras que sea cerca de mi casa para ir a recogerlo xD... mira, si ya cambiaron el sensor de posicion de cigueñal SIEMPRE deben cambiar tambien el fusible n° 38 que es el del encendido. los encendidos VW siempre dan problemas con el circuito de encendido. me cuentas, estoy pendiente de tu caso, mi mail es server.dll@gmail.com

Recuerda fusible n° 38
@Tsistemas Hace más de 3 meses
@jemolux23 y tambien cuando des arranque haslo con el pedal del acelerador hasta el fondo.
@pedrobecerrasilv Hace más de 3 meses
hola, mi nombre es Pedro y necesito vuestra ayuda. Tengo un chevrolet chevy 2004 diesel (petrolero), no enciende, no es bateria porque la saqué y cargué y no es alternador porque ya fue reparado hace algunos días, solo da un sonido igual a cuando das contacto estando el motor ya encendido, es exactamente el mismo ruido. bueno espero me puedan ayudar y si no pueden igual agradezco el gesto que hacen al compartir sus conocimientos. saludos.
@Tsistemas Hace más de 3 meses
ok, hola pedro, una duda... cuando giras la llave para arrancar el motor de partida gira y mueve el motor o solo escuchas un click????
@Nakouz Hace más de 2 meses
Hola! Tengo un peugeot 306 nafta 1.8 16v. El tema es el siguiente... A la posición de contacto llega perfecto, pero luego de eso, al intentar dar arranque se escucha un click y se corta la corriente general del coche.
La única manera de poder dar contacto nuevamete es habiendo desenchufado la batería y vuelto a conectarla. Pero vuelve a suceder lo mismo.
He revisado fusibles, la bomba de combustible funciona correctamente, desconecté la bobina, pero nada.
Pareciera como si se produjera un gran corto en algún lugar y el auto entrara en algún modo de protección.
Es justo al darle el arranque, no llega a girar el burro.

Ojala puedas ayudarme!
Muchas gracias.
@Tsistemas Hace más de 2 meses
@Nakouz lo mas probable es que ese sea el problema.
@Nakouz Hace más de 2 meses +1
@Tsistemas Muchas gracias! Era tan simple como limpiar los bornes de la batería.
Al revisarlo de noche y probar, se vió la chispa que hacía en el borne negativo.
Muchas gracias por la ayuda!!
@Tsistemas Hace más de 2 meses
@Nakouz exelente!!!! a veces la solucion mas simple es la correcta, limpiar los bornes con agua tibia y bicarbonato resulta muy efectivo. te falto terminar el comentario con "sos groso tigre, denunciado maquinola, despidete de tu cuenta troesma, van +10 lince..."
@Gear_gamer Hace más de 2 meses
Hola @Tsistemas ! ojala me puedas ayudar!
La semana pasada con mucho esfuerzo me compre un kia pop Lx 1.1 año 99 le costaba partir pero lo hacia! soy de Viña y desde la lluvia de hace 2 dias no parte! sin sacar las bujias revise que llegara corriente desde el cable y todo OK tambien llega bien la bencina! al ver las bujias desde afuera vi que eran todas diferentes, me dicen que cambie las bujias y cables de bujia, que puedo hacer si al cambiarlas sigue sin partir? el motor gira pero no se siente ninguna "explosion" como para partir!
De antemano Muuuchas gracias!!!
@Tsistemas Hace más de 2 meses
@Gear_gamer fijate en la correa de distribucion que esta oculta detras de una tapa plastica, lo mejor seria que grabaras un videito dandole arranque para ver que sonido tiene
@Gear_gamer Hace más de 2 meses
@Tsistemas Ya se soluciono! hable con la dueña anterior y me dijo que tenia un corta corriente oculto que pase a llevar! Cueeeck ...
De todas formas voy a cambiarle las bujias y cables de bujia, de todas formas que me recomendarias hacerle para que me dure 1 año sin problemas?

Saludos y gracias por la ayuda!
@Tsistemas Hace más de 2 meses +1
@Gear_gamer para que dure 1 año sin problemas primero un buen shell helix hx7 10w40 + su respectivo filtro de aceite, cambiarle filtro de bencina, filtro de aire, bujias + cables, calentarlo 10 min en la mañana (importante para que no falle la empaquetadura de culata), nada de manejar a lo "rati" o rapido y porrazo, mejor manejar a maximo 95khr para ahorrar combustible y desgaste de motor, no prestarlo a nadie. con eso te dura 1 año y economizas mucho en bencina.
@YEIYEI26 Hace más de 2 meses
buenas sos un groso .. te comento que compre un corsa 97full arranca inestable vibra todo el motor durante unos 30 segundo luego se normaliza , la bobina es original nunca la cambiaron ,, y note que al chispa en el 3y4 es mas fuerte notablemente que en la 1y2 .. las bujias se empastan muy seguido pero lo curioso es que no siempre son las mismas aveces 1 otrs 4 y asi .. alguna sugerencia.... mil gracias por lo que haces..
@YEIYEI26 Hace más de 2 meses
me olvide de comentar que son bujias nuevas y cables nuevos tambien se cambio la IAC gracias
@YEIYEI26 Hace más de 2 meses
gracias por tu rapida respuesta: he revisado el aceite como me dijiste y esta limpio revise tanto de la tapa como por la barilla y esta limpio con el nivel normal.... ahora la bobina no se como revisarla solo vi un post. que con el motor encendido iva desconectando uno por uno los cables de la bujia... hice eso y en la 1y2 veo con menos intensidad la chispa que en la 3y4, solo eso.
@YEIYEI26 Hace más de 2 meses
ha otra cosa mas es que cuando desconecte el cable 1 y 2 el motor siguio encendido pero cuando desconecte tanto el 3 como el 4 se apago enseguida...
@elchipilin65 Hace más de 2 meses
buenas tengo un mitsubishi gt 3000 año 1992 tiene chispa y gasolina pero no enciende
@Tsistemas Hace más de 2 meses
ohh que hermosa maquina, en realidad nunca vi uno de esos aca en chile, deberias especificar que cilindrada y motor viene en ese superauto...
@cachichie Hace más de 1 mes
Hola tengo un torino. Ts del 73. Y me dejo tirado en la calle 3 veces , me dijeron que el alternador funcionaba bien y que la bateria podria ser que estaba con un pie sobre la tumba , asi que compre una bateria nueva y la coloque ,peri cuando le doy marcha arranca y cuando le desconecto el positivo de la bateria se me apaga ayudaaaaa
@Tsistemas Hace más de 1 mes +1
si desconectas la bateria y el auto se detiene es por que el alternador esta en mal estado, debes enviarlo a reparar lo antes posible.
@cachichie Hace más de 1 mes
Eso quiere decir que. El alternador esta muerto ?? No quiero. Que me deje tirado de nuevo .
@Tsistemas Hace más de 1 mes
sip, el alternador esta muerto, prueba en cambiar la caja reguladora que es barata.
@JuTaGo Hace más de 1 mes
Hola maestro, una consulta.. tengo un fiat palio el 98 1.6 y tiene un problema que no me deja en paz. Cuando lo arranco en frío, arranca sin problemas, quizás con una que otra vuelta de mas, pero cuando calienta el motor, trato de arrancarlo y no hay manera, solo empujandolo. El motor gira pero extremadamente pesado. Si se enfría, arranca nuevamente. Ya le cambie el bendix del motor de arranque, batería le puse una de 65, bujías, cables y bobina. Cambie fusibles y relays. Ya no se me ocurre que mas arreglar. Me podrás dar una mano? Muchas gracias !!
@Tsistemas Hace más de 1 mes
Problema comun del sensor de TEMPERATURA del motor


puedes comprar el del corsa 1.6, son iguales...
@brian1133 Hace 29 días
hola maestro, tengo un astra 2011 2.0 nafta/Gnc 5ta generacion
me quede sin nafta ayer, le puse 5 litros y no quiere saber nada.. me seria de gran ayuda tu respuesta
@Tsistemas Hace 29 días
uufff quedarse sin nafta es muy malo para la bomba de combustible ya que lo que queda en el fondo del estanque es basurilla que se acumula y esta siempre tapa o traba la bomba... 2 opciones, la desarma y la soplas con buena presion de aire o te aseguras y la cambias por una bosch de 3 bar nueva.... saludos.
@Nestorrafael5 Hace 29 días
amigo mi carro tiene problema con la corriente de la bomba. hoy me qde accidentado y resulta que la bomba dejo de tener corriente. pensé que estaba dañada y la reemplace. ahora resulta que la nueva bomba tampoco enciende al pasar las llaves. estuve revisando los fusibles pero aparentemente todos están bien, pero no logro ubicar el fusible el de la bomba. sera q me puedes ayudar a identificar ese fusible?? tengo un Ford Fiesta 2001
@Tsistemas Hace 29 días
En el ford fiesta 2001 despues de un accidente debes desbloquear el SENSOR DE IMPACTO, se encuentra en el lado del copiloto bajo la alfombra (en los pies) hay un orificio donde metes el dedo un poco y se escucha un click, luego arranca normalmente...
@cachichie Hace 27 días
gracias por responder ¡¡ gracias lo puede reparar cambiando un diodo que estaba quemado ¡¡¡
@Tsistemas Hace 27 días
Que bueno que se soluciono, ahora si dejas unos puntos me sentiria mas alegre maquinola...
@lababau Hace 25 días
Hola, como estas, es fantastico lo que haces, te felicito por tus conocimientos y por la ayuda que brindas. Paso a contarte mi problema, tengo un clio rt 1997 naftero a GNC, basicamente no arranca en frio, es decir despues de pasar toda la noche, estando el motor frio no arranca, no es todos los dias, hubo dias en que arranco en el primer intento y otros que costo un poquito mas pero terminaba arrancando. Como se ahogaba de tanto darle arranque lo que yo hice fue destapar en donde esta el inyector para que se evaporara la nafta y al rato arrancaba, no se si fue casualidad o que pero arrancaba, una vez que arranco durante todo el dia me arranca perfecto, pero no anda como lo hacia antes, lo siento raro, de hecho a veces se para el motor en bajas revoluciones. La bomba de nafta funciona, chispa llega y el motor esta rectificado hace 6 meses, lei por ahi que podia ser el captador PMS o avioncito, apelo a tu sabiduria para que me digas si esto puede ser cierto o puede ser la bomba de nafta que no tira como deberia, desde ya muchas gracias y espero ansioso tu respuesta, abrazo desde Argentina...
@Tsistemas Hace 25 días
Amigo lababau a veces lo mas facil es la solucion, veo que ya revisaste los items mas frecuentes. descarta de plano el sensor de posicion de cigueñal, cuando este falla el auto simplemente no arranca. Cuando te enfrentas a un problema intermitente como este la mayoria de las veces es algo simple, en el clio 1.6 siempre se debe mantener el filtro de aire muy limpio o comienza adar esta falla, otra cosa que necesitan siempre es limpiar el cuerpo de la mariposa ya que se contamina y el sensor d
@lababau Hace 25 días
Pero si el filtro de aire esta sucio, porque me arranca sin problemas en caliente? solo me jode en frio. A que te referis con el cuerpo de la mariposa? al inyector? de ser asi se lo limpie hace poco, la bomba de nafta no es? gracias, abrazo...
@Tsistemas Hace 25 días
el aire mas caliente es menos denso que el frio, eso es principio fisico. lo que debes limpiar es la mariposa que se llena de suciedad debajo y presenta muchos problemas. suerte. sino tocara escanear.
@dagoberto123 Hace 24 días
Hola, tengo un honda crv del año 2000, queria ver que tipo de bujias utilizaba y deje un cable desconctado al rato lo hice andar y partio a los segundos se paro solo y ahora no arranca . Porfavor necesito alguna ayuda de que puedo hacer de verdad se lo agradeceria enormemente
@Tsistemas Hace 23 días
El CR-V usa bujias: DENSO KJ16CR-L11 y tambien puedes usar NGK: ZFR5F O ZFR6J

Cambia las bujias e intenta denuevo
@ronicol50 Hace 21 días
hola buen dia ..te cuento el problema que tengo.....choque el auto de frente y rompi radiador electro y condensador de aire...pare el auto..luego lo arranque y empeso a explosionar y hacer como un tacatacatacatacataca fuerte y explosionaba .. no toco motor ni movio nada...el auto es un palio adventure locker 1.6 es nuevo ..te agradeceria tu ayuda ...gracias
@Tsistemas Hace 21 días
Bueno, cuando uno choca de frente a veces con el impacto el motor se azota fuertemente y provoca que el soporte de motor se tuerza y se desplase cauzando rose en la correa de distribucion o en la proteccion plastica. (tambien puede probocar una salida de punto).

Otra cosa que puede causar ruido en un auto post choque son las esquirlas que saltan y se introducen por las aberturas de ventilacion del alternador. lo mejor seria que me envies un video para diagnosticar mejor.

@ronicol50 Hace 19 días
@Tsistemas muchas gracias por tu respuesta...te cuento fui al chapista ya me arreglo todo el auto solo chapa y el auto quedo como nuevo aparentemente...a simple vista por fuera esta nuevo y abris el capot igual nuevo..lo que si es que ahora no arranca .....te pregunto vos que sabes mucho...es posible que cuando choque el auto tenga algun dispositivo o algun corta combustible..? puede ser que cuando el auto se quede sin nafta ..aga esas explosiones y el tacatacatacataca...y solo pueda andar 2 c
@Tsistemas Hace 19 días
@ronicol50 no ronicol, cuando queda sin nafta despues no produce ese problema, necesitas llevarlo un mecanico, creo que tu motor esta golpeando las valvulas por un corte de la correa o desplazamiento de dientes en la correa de distribucion.
@DiscoStu23 Hace 21 días
Hola buen dia!!! veo que has podido ayudar a muchos y me gustaria ser uno mas de los que les has ayudado a solucionar el problema, resulta que tengo una voyager 1996 motor 3.3 y ya la lleve con un mundo de mecanicos de donde vivo, le metieron el Scaner 4 veces y no aparece falla alguna, cambie el sensor de oxigeno, 3 inyectores y lavaron los demas, cambie filtro de aire y gasolina, sensor maf, sensor tps, cambie las bujias 2 veces al igual que todos los cables, cambie bomba de gasolina y recien checaron precion y tenia buena precion, te menciono que todo esto se hizo porque le aceleraba y no respondia aceleraba lento, por ultimo iba por carretera y las revoluciones se subian y bajaban empezo a tirar humo y jalonearse y se apago y quedo la aguja de revoluciones asta arriba le doy marcha y se escuchan explociones en el motor y escape pero no prende ya les hablo a los mecanicos y nomas dicen que van a venir pero no vienen, creo que se sienten incompetentes o les da verguenza que no sepan cual es la falla. espero puedas ayudarme.
@Tsistemas Hace 20 días
@DiscoStu23 explosiones al filtro de aire??? esta bien el orden de encendido???? Pana
@DiscoStu23 Hace 20 días
@Tsistemas Si en ese orden esta
@DiscoStu23 Hace 20 días
@Tsistemas Y si las explociones son en el filtro de aire
@DiscoStu23 Hace 17 días
@Tsistemas Hola disculpa por no contestar anduve fuera, resulta que el dia de ayer por fin vino un mecanico a checarla y diagnostico que estaba fuera de tiempo, pero no la pudo reparar que hasta el dia de mañana y como no estube no le pude preguntar que tan grave era el asunto y caro... segun he sabido cuando se daña el tiempo se tuercen valvulas o algo asi en cierto tipos de vehiculos es verdad???
crees que el daño sea grave y caro?? me queda esa duda hasta que vea al mecanco.
@Tsistemas Hace 16 días
@DiscoStu23 el 3.3 tiene cadena de tiermpo, me extraña que este fuera de tiempo ya que es dificil que se corran dientes de la caena, a menos que la cadena este cortada...
@Tsistemas Hace 12 días
@DiscoStu23 y al final como te fue????
@elbetu Hace 14 días
Hola, te hago una consulta, tengo un opel vectra 94 2.0 que de repente no me arranco mas, no le llegan chispa a las bujias, el cable que viene de la bobina tiene chispa, o sea hasta el distribuidor llega... Mi pregunta es si es muy complicado desarmar este distribuidor ya que no se que me puedo encontrar adentro y no quiero meter la pata, por otro lado a lo mejor es una pavada y me evito una fortuna y un dolor de cabeza para trasaladarlo hasta el mecanico. Aguardo tus comentarios, muchas gracias. Saludos.
@Tsistemas Hace 14 días
si este es tu distribuidorTu Auto no enciende? AQUI Tips para solucionarlo!! [i.C]

no es para nada complicado, solo sueltas los 3 tornillos que trae, luego pones uno nuevo SIN PERDER EL ORDEN DE LOS CABLES, Trata de marcarlos o memorizar el orden, dentro del distribuidor hay un ROTOR que es el que distribuye la chispa en el momento correcto, el rotor tambien se cambia y es muy barato, para cambiar el rotor solo debes tirar de el e instalar el nuevo.

@FelipeGajardobet Hace 11 días

Tengo una consulta....

Tengo un honda civic de 1990 y cuando lo conduzco por 2 horas aproximadamente lo apago al detenerme... Y si lo quiero arrancar no hace nada, tampoco hace ruido el motor de arranque... Le doy unos 30 minutos hasta que se enfria y arranca como si nada hubiese sucedido... El motor toma mucha temperatura.... Esto me tiene asustado, espero tu ayuda. Desde ya muchas gracias.....

Pd: muy buen post... Saludos
@Tsistemas Hace 11 días
problema tipico de relays que no se enclavan por cambio de temperatura. prueba cambiar el relay que dice "starter" que esta en el vano motor y tambien prueba a cuando ya no arranca golpear el motor de arranque con algo metalico e intentar dar arranque (golpes fuertes)
@rubenhchaves Hace 7 días
Hola, el 21 de octubre lleve a hacer service aparte del service, le cambiaron la bateria, bomba de direccion hidraulica y correas, salió carísmo, ayer cuando lo quise arrancar no quiso. Le saqué un relay amarillo q parece que controla la alarma, se lo volví a colocar, encendí y apagué la alarma y arrancó. Lo apagué y no arrancaba, Saquél el mismo relay, prendí y apagué la alarma y arrancó, aparte el motor como que hace ruido que se acelera solo....¿que puede ser?
@Tsistemas Hace 6 días
La alarma esta activando el inmovilizador, deberias reprogramarla, si te cambiaron la bomba hidraulica de la direccion debes decirme si al girar el volante el ruido se acentua o se hace mas fuerte...
@davex77 Hace 4 días
Hola buenas tardes, tengo un Zuzuki fun hoy a la mañana lo use con normalidad y al medio dia cuando quize volver a usarlo no arranco, da contacto, prende las luces y el tablero pero no hace ruido solamente hace un pequeño crack , verifique la bateria y anda bien , me fije en la bomba de nafta y no es ,queria saber que puede ser.
@Tsistemas Hace 4 días
es el motor de arranque al cual ya no le quedan carbones, debes enviarlo a reparar, como solucion momentanea puedes golpearlo un poco con algo duro y arrancara un par de veces, luego de golpearlo un par de dias te aburriras de hacerlo y lo enviaras a reparar xd